Study approval
The Ethical Review Board in Stockholm, Sweden (archive numbers 2010/579-31 and 2016/615-32) has approved the use of human kidney tissue for the study. Informed consent was obtained from all individuals. The design and conduct of our study concerning human samples are compliant with our ethical permits and the Declaration of Helsinki.
Our experimental protocols in mouse were approved by The Ethical Committee for Research Animals, Linköping, Sweden (archive number DNR1336-19, DNR 14071-19). For rat work, our experimental protocols were approved by the Regional Laboratory Animal Ethics Committee of Gothenburg, Sweden (DNR 2327). All methods were performed according to relevant guidelines and regulations. Animals were housed in standard, single ventilated cages with 12 h light–12 h dark cycle and had ad libitum access to water and chow. The house temperature was maintained as 20 ± 2 °C and the relative humidity was kept as 50 ± 5%. All methods used are compliant with ARRIVE guidelines.
Human tissue
Kidney samples were obtained from patients undergoing nephrectomies. Only histologically healthy parts of the kidney poles were used.
Transgenic mouse lines
We generated a floxed NPR3mouse line (C57Bl/6J background, NPR3fl/fl; Cyagen) in which exon 3 was targeted. The line was crossed with podocin cre (B6.Cg-Tg [NPHS2-cre] 295Lbh/J; Jackson Laboratory) to generate a cell-specific knockout mice (NPR3PodKO). The Gt (ROSA)26Sortm14(CAG-td-Tomato)Hze/J mice were crossed with the podocin-cre line to activate the td-Tomato expression specifically in podocytes. The genotyping was done by PCR using genomic DNA extracted from ear biopsies. Primers for genotyping were: NPR3-LoxP-F: 5′ggtggcagaagatattttagggtttg3′, NPR3-LoxP-R: 5′cttaccccaggctgagcttcttt3′, Cre-F: 5′gcggtctggcagtaaaaactatc3′, Cre-R: 5gtgaaacagcattgctgtcactt5´.
Anti-GBM glomerulonephritis model
NPR3PodKO and C57Bl/6J control mic (9–11 weeks of age) were pre-immunized subcutaneously with 400µl/kg of sheep IgG Freund’s complete adjuvant (F5881, Sigma-Aldrich). Four days later, glomerulonephritis was induced by an intravenous injection of 130 μl of nephrotoxic serum (NTS) purchased from Probetex (PTX-001S). Urine was collected (day 0, 7, 14) and animals were sacrificed, and organs collected 14 days after the induction of the disease. Histopathology of animals was evaluated by scoring at least 30 glomeruli/mice as “normal” or “abnormal” (defined by presence of mesangial expansion, segmental sclerosis, crescents, and necrosis). Albuminuria was analyzed by running 2 µl of urine on SDS-PAGE gel (Invitrogen) and stained with SimplyBlue Safe stain (Invitrogen).
Treatment of glomerulonephritis model with NPR3 inhibitor
NPR3 selective inhibitor (NPR3i; AZ12107657/M37204915) (15mg/kg) or vehicle (water/DMSO 50/50) was delivered continuously throughout the treatment period via Alzet micro-osmotic pumps (model 1002, Agnthos AB, Sweden). The osmotic pumps were implanted subcutaneously one day prior to the induction of glomerulonephritis in mice according to manufacturer’s instructions. The mice were followed up with body weight and urine collected every other day. On the final day mice were anesthetized with isoflurane followed by cervical dislocation to proceed with urine, blood, and organ collection.
Rat diabetic kidney injury model
Male ZSF1 rats were purchased at 10-week of age from Charles River (Charles River, USA). Two groups of obese (ZSF1-LeprfaLeprcp/Crl 378), and lean (ZSF1-LeprfaLeprcp/Crl 379) animals were used in the following experiments. A total of 8-lean animals were used as a control group throughout the experimental setup. After 2 weeks of acclimation, obese ZSF1 rats were uninephrectomised (UNx) by removal of the right kidney. The animals underwent a two-week recovery period, followed by randomisation into different treatment groups (n = 10/treatment group). Treatment groups included: lean = unchallenged lean rats; vehicle = ZSF1, UNx rats treated with subcutaneous injection of a vehicle; NPR3i = ZSF1, UNx rats treated with subcutaneous injection with NPR3i; ARB = ZSF1, UNX rats treated with Losartan in drinking water, NPR3i + ARB = ZSF1, UNx rates treated with subcutaneous injection with NPR3 selective inhibitor and Losartan in drinking water. For dosing of the different treatments, the following was used: vehicle: normal saline (pH 5–6) (1 ml/kg), three times a week subcutaneous injection (week 1–5) then once daily subcutaneous injection (week 6–10). NPR3i: NPR3i (15 mg/kg, 1 ml/kg), three times a week subcutaneous injection (week 1–5), once daily subcutaneous injection week (6–10). Losartan: Losartan potassium (PHR1602-1G, Sigma-Aldrich) (20 mg/kg/day), in drinking water.
The animals were kept for a total of 10 weeks under treatment with constant follow-up and monitoring. Body weight and blood glucose were measured at baseline and once a week after the initiation of treatment. Animals were placed in metabolic cages at baseline, after 4 and 9 weeks of treatment for urine collection. After 10-weeks rats were anesthetized with isoflurane followed by exsanguination and disruption of blood flow.
Quantitative PCR
Glomeruli were isolated from human and mouse kidneys as published previously16. Mouse podocytes from tdTomato mice were isolated as described16. Total RNA was extracted using RNeasy mini kit (Qiagen). First-strand cDNA synthesis was carried out using the iScript cDNA Synthesis Kit (BioRad). For real-time qPCR analysis, the CFX96Real-Time PCR Detection System and iQ SYBR Green Supermix (Bio-Rad) were used. The relative gene expression was calculated with the 2−ΔΔCq method normalizing the gene of interest to housekeeping gene in the same sample. Data are presented as relative fold-change. Used primers can be found in supplemental Table 1.
Immunostainings
Human frozen kidney sections were fixed in ice-cold acetone and blocked using 5% normal goat serum solution for 1 h at room temperature. Mouse kidneys were fixed with 4% paraformaldehyde and subsequently embedded with paraffin. Paraffin-embedded kidney sections (4 μm) were processed with antibodies to the antigens described below. For immunofluorescent studies, after HIER treatment with Tris–EDTA pH 9 for 20 min at 100 °C, sections were blocked using 5% normal goat serum solution for 1 h at room temperature.
Frozen and/or paraffin sections were incubated with NPR3 (ab97389, abcam, 1:1000), Synaptopodin (61094; Progen, 1:700), CD31 (303105; Biolegend, 1:500), PDGFRβ (MAB1263; R&D System, 1:1000), Nephrin (BP5030; Origene, 1:200), Wilms-Tumor1 (WT1) (ab89901; abcam, 1:100), ⍺-smooth muscle actin (A5228; Merck, 1:1000), tdTomato (TA150128; Origene, 1:50) at 4 °C overnight. Alexa Fluor conjugated secondary antibodies (Invitrogen) were used for visualization. All slides were co-stained with Hoechst 33342 (H3570, Life Technologies: 1:10,000). For paraffin embedded sections an extra step of incubation with sudan black B (0.1% in 70% ethanol, #199664, Sigma-Aldrich) solution was applied before mounting in Dako fluorescent medium (S3023, Agilent).
Transmission electron microscopy
Samples for TEM were fixed in 2.5% glutaraldehyde and processed by the electron microscopy unit core facility (EMil) at Karolinska Institutet, Huddinge University hospital following standard procedures. Electron microscopic exmanitaion was performed by FEI Tecnai Spirit BioTWIN.
Sanger sequencing
cDNA from wildtype (WT) and conditional knockout mouse glomeruli (NPR3PodKO) was amplified using PCR. The amplification product was isolated using Zymoclean Gel DNA Recovery Kit (ZymoResearch) according to the manufacturer’s instructions. Sanger sequencing was performed at KIGene facility at Karolinska Institutet, Solna following standard protocols.
Biochemistry
Serum and urine cGMP were measured using enzyme immunoassay kit (#CG201-1KT, Sigma-Aldrich). Creatinine was measured using Quantichrome creatinine assay kit (#DICT-500, Bioassay systems) respectively. The urinary albumin/creatinine ratio was measured by using the commercial kits Albuwell (#1011, Exocell).
Statistical analysis
Statistical analysis was performed with GraphPad Prism software (La Jolla, CA). For in vivo, in vitro and ex vivo experiments, data were analyzed using Student’s t-test or one-way ANOVA followed by Tukey’s multiple comparisons test when appropriate. For multiple treatment groups comparisons in the diabetic rat model mixed model ANOVA was used. A p value inferior to 0.05 was considered statistically significant. All data are presented as mean ± SD.
- The Renal Warrior Project. Join Now
- Source: https://www.nature.com/articles/s41598-024-61603-4